| some MCQ'S with answers ::from XXMC site.... recall your memory -
18-04-2006, 08:44 AM
note :: answers are at the end of this post
1>Most fascia of the body that attach to bones attach by which of the
following mechanisms?
A. Blending with the covering periosteum
B. Inserting deeply into the cancellous bone
C. Inserting deeply into the cartilage
D. Inserting deeply into the diaphysis
E. Inserting deeply into the marrow
2>A 35-year-old woman notices a change in the appearance of a mole on her
neck. Physical examination reveals that the lesion is an irregular, nodular,
superficial mass with a variegated appearance. Biopsy demonstrates a primary
malignant tumor. Which of the following factors is most predictive of the
patient's long term prognosis?
A. Circumference of lesion
B. Darkness of lesion
C. Degree of color variation
D. Depth of lesion
E. Sharpness of border between lesion and adjacent skin
3>A 43-year-old, insulin-dependent diabetic patient is diagnosed with
hypertension and begins therapy with an antihypertensive agent. Three
days later, he measures his blood glucose at home and finds that it
is 53 mg/dL. He recalibrates his glucose testing apparatus and repeats
the test, only to find that the first reading was accurate. He is
concerned that his hypoglycemia did not produce the normal premonitory
signs and symptoms. Which of the following medications was most likely
prescribed to treat his hypertension?
A. Captopril
B. Diltiazem
C. Methyldopa
D. Prazosin
E. Propranolol
4>A 33-year-old woman presents with fever, vomiting, severe irritative
voiding symptoms, and pronounced costovertebral angle tenderness.
Laboratory evaluation reveals leukocytosis with a left shift; blood
cultures indicate bacteremia. Urinalysis shows pyuria, mild hematuria
, and gram-negative bacteria. Which of the following drugs would best
treat this patient's infection?
A. Ampicillin and gentamicin
B. Erythromycin
C. Gentamicin and vancomycin
D. Phenazopyridine and nitrofurantoin
E. Tetracycline
5>A 32-year-old, blood type A positive male receives a kidney transplant from
a blood type B positive female donor with whom he had a 6-antigen HLA match.
Once the kidney is anastomosed to the man's vasculature, the transplant
team immediately begins to observe swelling and interstitial hemorrhage.
After the surgery, the patient developed fever and leukocytosis
and produced no urine. Which of the following is the most likely
explanation?
A. Acute rejection due to antibody-mediated immunity
B. Acute rejection due to cell-mediated immunity
C. Chronic rejection due to cell-mediated immunity to minor HLA antigens
D. Hyperacute rejection due to lymphocyte and macrophage infiltration
E. Hyperacute rejection due to preformed ABO blood group antibodies
6>A cardiovascular physiologist is performing experiments using a
new alpha1 adrenergic agonist to determine the amount of vasoconstriction
the new drug can produce compared with a phenylephrine control. Which of
the labeled structures is the cellular target of both of these drugs?
A. A
B. B
C. C
D. D
E. E
7>A patient with familial hypercholesterolemia undergoes a detailed
serum lipid and lipoprotein analysis. Studies demonstrate elevated
cholesterol in the form of increased LDL without elevation of other
lipids. This patient's hyperlipidemia is best classified as which of
the following types?
A. Type 1
B. Type 2a
C. Type 2b
D. Type 3
E. Type 5
8>A chronic alcoholic develops severe memory loss with marked
confabulation. Deficiency of which of the following vitamins
would be most likely to contribute to the neurologic damage
underlying these symptoms?
A. Folic acid
B. Niacin
C. Riboflavin
D. Thiamine
E. Vitamin B12
9>In the clotting process, as the hemostatic plug develops, fibrin
polymerizes into monomeric threads which are held together
by noncovalent bonds. Which clotting protein increases the
strength of the clot by crosslinking the newly formed fibrin threads?
A. Factor XIII
B. High molecular weight kininogen (HMWK)
C. Plasminogen
D. Thrombin
E. von Willebrand Factor (vWF)
10>A 72-year-old male is noted as having a 9-pound weight loss
over the past few weeks. His past medical history is significant
for oat cell carcinoma of the lung, without known metastases, for
which he is currently undergoing treatment. The patient states that
even though his wife is preparing his favorite meals, he is not hungry.
Which of the following would be the best treatment option to improve his
eating habits?
A. Amitriptyline
B. Megestrol acetate
C. Methotrexate
D. Neostigmine
E. Prochlorperazine
11>An archaeologist who has been excavating a very old Middle
Eastern site develops a pustule on his hand. The pustule then
ruptures to form a black eschar surrounded by expanding brawny
edema. Which of the following organisms is the most likely cause
of this condition?
A. Bacillus anthracis
B. Borrelia burgdorferi
C. Francisella tularensis
D. Spirillium minus
E. Yersinia pestis
12>A 48-year-old white female secretary presents with progressive
difficulty typing over the past month. She also notes that her hands
begin to feel numb and weak after typing for long periods of time.
Upon testing, which of the following deficits would be predicted?
A. Difficulty in abducting the fifth finger
B. Difficulty in adducting the thumb
C. Difficulty in flexing digits two and three at the
metacarpophalangeal joints
D. Loss of sensation over the lateral half of the dorsum
of the hand
E. Loss of sensation over the lateral half of the palm
F. Loss of sensation over the medial half of the dorsum
of the hand
G. Loss of sensation over the medial half of the palm
13>A boy with Duchenne muscular dystrophy (DMD) was born to parents
with no family history of the disease. The most likely explanation for
this occurrence is
A. a CGG expansion that resulted in the disruption of the promoter of the dystrophin gene
B. infidelity
C. a point mutation in the dystrophin gene
D. a recombination event in the dystrophin gene that gave rise to a frameshift mutation leading to an untranslatable mRNA
E. a translocation that resulted in the disruption of the dystrophin gene
14>An obese patient is brought into the emergency room in shock and
in need of intravenous fluids. No superficial veins can be seen or
palpated. The emergency room physician decides to make an incision
to locate the great saphenous vein for the insertion of a cannula
("saphenous cutdown"). In which of the following locations should
the incision be made?
A. Anterior to the lateral malleolus
B. Anterior to the medial malleolus
C. On the dorsum of the foot, lateral to the extensor hallucis longus tendon
D. Posterior to the lateral malleolus
E. Posterior to the medial malleolus
15>A 2-year-old child with leukemia develops nephrotic syndrome.
Light microscopic studies are normal. Electron microscopic studies
demonstrate fusion of epithelial foot processes. The current hypothesis
for the pathogenesis of this change is that it is secondary to which
of the following?
A. Consumption of complement factors
B. IgG directed against basement membrane
C. Immune complex deposition
D. Lymphokine production by T cells
E. Mesangial IgA deposition
16>A 4-year-old boy is seen by his pediatrician for epistaxis.
The patient has a history of multiple bacterial and viral respiratory
tract infections and eczema. An uncle had similar problems. Physical
examination is remarkable for multiple petechial lesions on the skin
and mucous membranes. Serum IgE is increased, and platelets are decreased.
Which of the following is the most likely diagnosis?
A. Acquired hypogammaglobulinemia
B. Ataxia telangiectasia
C. DiGeorge syndrome
D. Selective IgA deficiency
E. Wiskott-Aldrich syndrome
17>A healthy, 37-year-old, recently divorced woman loses her job
at the auto factory. She picks up her three young children from the
factory day care center and gets into an automobile accident on the
way home. Her 5-year-old son, who was not wearing a seat belt, sustains
a severe head injury. The woman was not hurt in the accident,
but is hyperventilating as she sits in the waiting room at the
hospital. She complains of feeling faint and has blurred vision.
Which of the following is decreased in this woman?
A. Arterial oxygen content
B. Arterial oxygen tension (PO2)
C. Arterial pH
D. Cerebral blood flow
E. Cerebrovascular resistance
18>A 32-year old women complains of amenorrhea since delivery of
a baby 15 months previously, despite the fact that she did not breast
feed her baby. The delivery was complicated by excessive hemorrhage that
required transfusion of 2.5 liters of blood. She has also been fatigued
and has gained an additional 10 pounds since the baby was born. Laboratory
data show the following: Serum LH < 1 IU/L (normal, 4-24 IU/L) Serum
estradiol 5 pg/mL (normal, 20 - 100 pg/mL) Serum
TSH 0.1 mU/L (normal, 0.5 - 5 mU/L) Serum GH 3 ng/mL (normal, < 5 ng/mL)
Serum ACTH 28 pg/mL (normal, 10 - 50 pg/mL) Serum prolactin 2 ng/mL
(normal, <20 ng/mL) Injection of 500 mg of TRH failed to produce the
expected rise in both serum TSH and prolactin. Which of the following
diagnoses most likely explains the findings in this patient?
A. Hashimoto's thyroiditis
B. Isolated gonadotropin deficiency
C. Primary amenorrhea
D. Prolactinoma
E. Sheehan's syndrome
19>A 7- year-old girl develops behavioral changes, and her
performance in school begins to deteriorate. Several months
later she develops a seizure disorder, ataxia, and focal
neurologic symptoms. She is eventually quadriparetic, spastic,
and unresponsive. Death occurs within a year. This patient may
have had which of the following viral diseases at 1 year of age?
A. Chickenpox
B. German measles
C. Measles
D. Mumps
E. Parvovirus B19
20>A 40-year-old, moderately obese man presents with a persistent
productive cough. The cough has been present for several weeks,
but recently the man noted that his sputum has assumed a greenish
color. Further questioning elicits a history of productive cough
, usually in the winter months, over the past several years. He
has smoked two packs of cigarettes per day since he was 16 years old.
On examination, the man is febrile (100° F), and coarse rhonchi and
wheezes can be appreciated bilaterally. Which of the following is
the most likely diagnosis?
A. Bronchogenic carcinoma
B. Chronic bronchitis with superimposed infection
C. Cystic fibrosis
D. Emphysema
E. Pulmonary tuberculosis
21>A 7-year-old patient presents with a mass in the anterior
midline of the neck, slightly above the larynx. The mass is mobile
and elevates upon protrusion of the tongue. This mass is most likely
a cyst that developed from which of the following embryonic structures?
A. First pharyngeal cleft
B. First pharyngeal pouch
C. Second pharyngeal cleft
D. Second pharyngeal pouch
E. Thyroglossal duct
22>An elderly man comes to medical attention because of anemia and
multiple infections. Physical examination is remarkable for
hepatosplenomegaly. An automated blood count demonstrates pancytopenia.
Review of the peripheral smear by a hematologist demonstrates rare,
distinctive, neoplastic white cells covered by fine, hairlike projections.
Which of the following characteristics would likely be associated with
these cells?
A. Birbeck granules
B. Elevated leukocyte alkaline phosphatase
C. Philadelphia chromosome
D. Positive tartrate-resistant acid phosphatase
E. Production of Bence-Jones proteins
23>A patient develops a swollen and tender lymph node in his popliteal
fossa. An infected skin lesion in which of the following sites would most
likely induce lymphadenopathy in this region?
A. Lateral side of the dorsum of the foot
B. Lateral side of the thigh
C. Medial side of the leg below the knee
D. Medial side of the sole of the foot
E. Medial side of the thigh
24>1. Internal oblique
2. External oblique
3. Peritoneum
4. Transversus abdominis
A surgeon performing an appendectomy makes an incision through the
ventrolateral wall. Which of the following corresponds to the order
of penetration of the layers of the abdominal wall?
A. 1-3-4-2
B. 2-1-3-4
C. 2-1-4-3
D. 4-1-2-3
E. 4-2-1-3
25>A 50-year-old physician is recovering from aseptic meningitis that
began two weeks ago. He appears to have lost considerable cognitive function,
and he says he will not go on living if his cognitive ability remains
compromised. To demonstrate to him that recovery is occurring, serial
evaluations with which of the following psychological assessments is
indicated?
A. Halstead-Reitan Battery
B. Stanford Binet Intelligence Test
C. Vineland Adaptive Behavior Scale
D. Wechsler Adult Intelligence Scale
E. Wide Range Achievement Test
26>A 37-year-old woman is abducted, beaten, and repeatedly raped. For
five months after the attack she is nervous, tearful, easily fatigued,
and has difficulty concentrating. She also notes difficulty sleeping and
lack of appetite, and is hyperreactive to unexpected or loud stimuli.
By six months she has returned to her characteristic pre-attack behavioral
patterns. Which of the following is the most likely diagnosis?
A. Acute stress disorder
B. Adjustment disorder with mixed anxiety and depressed mood
C. Major depressive disorder
D. Panic disorder without agoraphobia
E. Post-traumatic stress disorder
27>A 67-year-old black man with a history of glucose-6-phosphate
dehydrogenase (G-6-PD) deficiency presents with fever, irritative
voiding symptoms, and perineal pain. Rectal examination is remarkable
for a boggy, exquisitely tender prostate. A urine Gram's stain is
positive for gram-negative rods. The risk for development of hemolytic
anemia is highest if he receives high-dose, 21-day therapy with
A. ampicillin
B. cefaclor
C. ciprofloxacin
D. sulfamethoxazole/trimethoprim
E. tetracycline
28>A patient, who appears to be female, is found to be 46,XY. The
patient's vagina is very shallow, ending in a blind pouch, and there
are palpable masses in the labia. The diagnosis of testicular feminization
syndrome is made. Which of the following was most likely present during the
early fetal life of this individual?
A. A streak ovary
B. A uterus
C. An oviduct
D. Depressed levels of testosterone
E. MIF (Mullerian inhibitory factor)
29>A patient develops a form of lung cancer that spreads to occlude
the thoracic duct. Edema involving which of the following sites might
be expected as a potential complication?
A. Entire left side and right leg
B. Entire right side and left leg
C. Left arm only
D. Right arm and right half of head only
E. Right arm only
30>A patient develops an acute febrile illness with shivers, nonproductive
cough, and pleuritic chest pain. Five days later, he presents to the
emergency room after abruptly having "coughed up" nearly a cup of
blood-stained sputum. Which of the following is most likely to be seen
on chest x-ray?
A. A cavity with a fluid level
B. Blunting of diaphragmatic costal angles
C. Complete opacification of one lobe with no additional findings
D. Patchy consolidation centered on bronchi
E. Prominent bronchi that can be followed far out into the lung fields
31>Maintenance of the corpus luteum during the first trimester of
pregnancy is accomplished principally by the secretion of
A. antidiuretic hormone (ADH)
B. follicle stimulating hormone (FSH)
C. human chorionic gonadotropin (hCG)
D. luteinizing hormone (LH)
E. progesterone
32>A 15-year-old boy is evaluated by a clinician for failure to
develop normal male secondary sexual characteristics. Physical
examination reveals small testes, a small penis, and gynecomastia.
The boy has had some difficulties in school, and the parents say that
the school psychometrist said he had an IQ of 90. This patient's condition
is most likely to be related to which of the following?
A. Deletion
B. Nondisjunction of an autosomal chromosome
C. Nondisjunction of a sex chromosome
D. Non-Robertsonian translocation
E. Robertsonian translocation
33>A 52-year-old female presents with groin pain . Physical examination
reveals a bulge in the groin area immediately inferior to the inguinal
canal. The physician suspects that the patient has a femoral hernia
containing a loop of small intestine. Which of the following structures
is located immediately medial to the hernia sac?
A. Femoral artery
B. Femoral nerve
C. Femoral vein
D. Inferior epigastric artery
E. Lacunar ligament
34> The modified structures at the border of the epithelium shown
above are immotile in a 23-year-old patient. Which of the following
would be a consequence of this lack of motility?
A. Implantation failure
B. Kartagener's syndrome
C. Malabsorption syndrome
D. Reduction in number of disaccharidases
E. Uptake and digestion of spermatid residual bodies
35>A patient with tuberculosis develops bright orange-red urine and calls his
physician in a panic because he is afraid he is bleeding into the urine.
The patient has no other urinary tract symptoms. Which of the following
medications is most likely to produce this side effect?
A. Ethambutol
B. Isoniazid
C. Pyridoxine
D. Rifampin
E. Streptomycin
36>Which of the following Starling force changes is the primary cause of
the edema seen in patients with nephrotic syndrome?
A. Decreased capillary hydrostatic pressure (Pc)
B. Decreased capillary oncotic pressure (pc)
C. Decreased interstitial hydrostatic pressure (Pi)
D. Decreased interstitial oncotic pressure (pi)
E. Increased capillary hydrostatic pressure (Pc)
F. Increased capillary oncotic pressure (pc)
G. Increased interstitial hydrostatic pressure (Pi)
H. Increased interstitial oncotic pressure (pi)
37>HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC ... UAU UAA
Hemoglobin is isolated from the erythrocytes of a young child with anemia.
Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin,
known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain.
The normal sequence of the b-globin gene (HbNl) and the sequence of the
HbCr b-chain are presented above. Which of the following would account
for the development of HbCr?
A. A frameshift mutation resulted in the deletion of several amino acid residues in the b-chain
B. A mutation in the stop codon resulted in elongation of the b-chain
C. A point mutation resulted in the insertion of a stop codon in the b-chain
D. A two base pair addition resulted in the elimination of a stop codon in the b-chain
E. A two base pair deletion resulted in truncation of the b-chain
38>
What is the primary function of the cell pointed to in the figure above?
A. It produces low-molecular weight polypeptides
B. It secretes bactericidal enzymes
C. It secretes lipases
D. It secretes mucins
E. It secretes pepsinogen
39>A 37-year-old woman who was diagnosed with AIDS 3 years earlier is
unable to work, is physically debilitated, and requests her physician to
provide her with medications with which to take her own life. The most
common emotional disorder that results in such requests by patients is
A. bipolar I disorder, manic type
B. borderline personality disorder
C. factitious disorder
D. major depressive disorder
E. schizophrenic disorder
40>IV administration of drug X to an anesthetized animal produces an
increase in blood pressure. After administration of drug Y,
readministration of drug X produces a decrease in blood pressure.
Which of the following pairs of drugs could produce this sequence of events?
Drug X Drug Y
A. Acetylcholine Neostigmine
B. Epinephrine Phentolamine
C. Isoproterenol Atropine
D. Norepinephrine Propranolol
E. Phenylephrine Hexamethonium
41>A 25-year-old woman with sickle cell anemia complains of steady pain
in her right upper quadrant with radiation to the right shoulder,
especially after large or fatty meals. Her physician diagnoses gallstones.
Of which of the following compounds are these stones most likely composed?
A. Calcium bilirubinate
B. Calcium oxalate
C. Cholesterol
D. Cholesterol and calcium bilirubinate
E. Cystine
42>A patient with prolonged diarrhea undergoes esophagogastroduodenoscopy.
Biopsy of the small intestine demonstrates numerous crescent-shaped
protozoa adjacent to the epithelial brush border. Which of the following
organisms is the most likely pathogen?
A. Entamoeba histolytica
B. Escherichia coli
C. Giardia lamblia
D. Naegleria fowleri
E. Trichomonas vaginalis
43>A neuroscientist is investigating the development of the nervous
system. In his experiments, he microinjects a dye into the embryo of
an animal subject in vivo. After birth, he performs histological
studies to determine the destination of the dye. In one animal subject,
he locates the dye in the dorsal horn of the spinal cord. Which of the
following locations in the embryo was the most likely site of the injection?
A. Alar plate
B. Basal plate
C. Neural crest
D. Rostral end of neural tube
E. Sulcus limitans
44>The heart of an embryo first begins beating at which of the following ages?
A. 2 weeks
B. 3 weeks
C. 4 weeks
D. 6 weeks
E. 8 weeks
45>Which of the following respiratory system components is derived
from neural crest?
A. Endothelial cells
B. Epithelium of primary bronchi
C. Laryngeal cartilage
D. Tracheal glands
E. Type I pneumocytes
46>A 36-year-old Asian male complains of difficulty swallowing.
Esophagoscopy reveals a polypoid mass that is subsequently biopsied.
In addition to tumor cells, the esophageal biopsy show normal smooth
muscle and striated muscle in the same section. Which portion of the
esophagus was the source of this biopsy?
A. Lower esophageal sphincter
B. Lower third of the esophagus
C. Middle third of the esophagus
D. Upper esophageal sphincter
E. Upper third of the esophagus
47>Which of the following hormones is secreted by anterior pituitary
cells that stain with acidic dyes?
A. ACTH
B. FSH
C. LH
D. Prolactin
E. TSH
48>A 20-year-old develops weakness accompanied by difficulty in relaxation
that is most pronounced in the hands and feet. Muscle biopsy demonstrates
prominent ring fibers, centrally located nuclei, chains of nuclei, and
disorganized sarcoplasmic masses. This condition been associated with a
mutation on which of the following chromosomes?
A. X
B. Y
C. 4
D. 5
E. 19
49>A 24-year-old woman in her third trimester of pregnancy presents
with urinary frequency and burning for the past few days. She denies
fever, nausea, vomiting, or chills. She takes no medications besides
prenatal vitamins and is generally in good health. Physical examination
is remarkable for mild suprapubic tenderness, and a urine dipstick is
positive for white blood cells, protein, and a small amount of blood.
Culture produces greater than 100,000 colonies of gram-negative bacilli.
which of the following attributes of this uropathogenic organism is most
strongly associated with its virulence?
A. Bundle-forming pili
B. GVVPQ fimbriae
C. Heat labile toxins
D. Heat stable toxins
E. P pili
F. Type 1 pili
50> A baby who was apparently normal at birth, develops persistent
regurgitation and vomiting in the second and third weeks of life.
No fever is present and hematologic studies and blood chemistries
are normal. Which of the following therapies is most likely to be
effective in this case?
A. Antacids
B. Barium enema
C. Gastric resection
D. Oral antibiotics
E. Pyloromyotomy
Answers
1>The correct answer is A. Fascial straps (retinacula) and fascial
coverings of muscles or muscle groups characteristically attach to
nearby bones by blending with the covering periosteum. No deep
attachments are usually made by fascia.
Cancellous bone (choice B) is spongy bone, which is usually found
in marrow, and is not the site for fascial attachment.
Fascia do not usually attach to cartilage (choice C).
Fascia attaches to bony shafts, or diaphyses (choice D), superficially
via the periosteum.
Fascia do not penetrate the bone to reach the marrow (choice E).
2>The correct answer is D. The lesion is a malignant melanoma.
Melanomas can develop either de novo or in an existing mole. Sunlight
exposure is a significant risk factor and fair-skinned persons are at
increased risk of developing melanoma. The most significant factor for
long term prognosis is the depth of the lesion, since the superficial
dermis lies about 1 mm under the skin surface, and penetration to this
depth is associated with a much higher incidence of metastasis than is
seen with a more superficial location.
The circumference of the lesion (choice A) is much less important than depth
, since one form of melanoma (superficial spreading) can still have good
prognosis despite large size, if it has not extended to the depth of the
superficial dermal lymphatic bed.
The darkness (choice B) or degree of variation in color (choice C) do not
have prognostic significance once melanoma is diagnosed.
Irregularity, or fuzziness at the border (choice E) of a mole-like lesion
is a good clue to potential malignancy, but does not affect prognosis once
a melanoma is diagnosed.
3>The correct answer is E. Beta-adrenergic blockade may blunt or prevent
the premonitory signs and symptoms (e.g., tachycardia, blood pressure
changes) of acute episodes of hypoglycemia. Non-selective beta-blockers,
such as propranolol, may even potentiate insulin-induced hypoglycemia.
Even though this effect is less likely with cardioselective agents, the
use of either cardioselective or non-selective beta-blockers in diabetics
is not recommended due to their "masking" effect of the normal warning
signs and symptoms of hypoglycemia. None of the drugs listed in the othe
r choices will blunt the premonitory signs and symptoms of hypoglycemia.
Captopril (choice A) is an angiotensin-converting enzyme (ACE) inhibito
r that can be safely used for the treatment of hypertension in diabetic
patients.
Diltiazem (choice B) is a calcium channel blocker that is also considered
to be safe and effective for the treatment of hypertension in diabetic
patients.
Both methyldopa (choice C), a centrally acting alpha-adrenergic agonist
, and prazosin (choice D), an alpha1-adrenergic antagonist, can be safely
used to treat hypertension in diabetic patients. However, due to the side
effect profile of these medications, they are generally used only in
diabetic patients who are unresponsive to ACE inhibitors and calcium
channel blockers.
4>The correct answer is A. Acute pyelonephritis is an infectious disease
involving the kidney parenchyma and the renal pelvis. Gram-negative
bacteria, such as Escherichia coli, Proteus, Klebsiella, and Enterobacter,
are the most common causative organisms in acute pyelonephritis.
Laboratory evaluation will often reveal leukocytosis with a left shift,
and urinalysis typically shows pyuria, varying degrees of hematuria
, and white cell casts. Since bacteremia is present, the patient should
be hospitalized and empirically started on IV ampicillin and gentamicin
. This regimen may be need to be changed, however, once the sensitivity
results are available.
Erythromycin (choice B) and tetracycline (choice E) are both bacteriostatic
antibiotics and would not be recommended in a patient with a severe
infection, such as acute pyelonephritis with bacteremia.
Vancomycin (choice C) is primarily used in the treatment of severe
gram-positive infections.
Phenazopyridine (choice D) is a urinary analgesic, and nitrofurantoin
(choice D) is a urinary tract anti-infective. Although nitrofurantoin is
indicated for the treatment of "mild" cases of pyelonephritis, as well
as cystitis, this patient's condition is severe and should be treated with
appropriate antibiotics.
5>The correct answer is E. The patient is suffering from hyperacute
rejection due to the preformed anti-B ABO blood group antibody found
in all type A positive individuals. Hyperacute rejection occurs within
minutes to a few hours of the time of transplantation, and is due to
the destruction of the transplanted tissue by preformed antibodies
reacting with antigens found on the transplanted tissue that activate
complement and destroy the target tissue. Preformed antibodies can
also be due to presensitization to a previous graft, blood transfusion,
or pregnancy.
Acute rejection due to antibody-mediated immunity (choice A) is incorrect
because this patient suffered from hyperacute rejection (immediate)
occurring within minutes to hours, rather than days.
Acute rejection due to cell-mediated immunity (choice B) will not occur
until several days or a week following transplantation. Acute rejection
is due to type II and type IV reactions.
Chronic rejection, due to the presence of cell-mediated immunity to minor
HLA antigens (choice C), occurs in allograft transplantation months to
even years after the transplant. Chronic rejection is generally caused
by both humoral and cell-mediated immunity.
An accelerated acute rejection, occurring in 3-5 days, can be caused by
tissue infiltration and destruction by presensitized T lymphocytes and
macrophages (choice D) and/or antibody-dependent, cell-mediated cytotoxicity
(ADCC). Note that this is not a hyperacute reaction.
6>The correct answer is E. Arrow E points to a smooth muscle cell in
the media of the arteriole. Alpha1 agonists stimulate alpha1 receptors
present on the smooth muscle, which leads to an increase in intracellular
calcium via phosphatidylinositol hydrolysis. This increase in calcium is
necessary for smooth muscle contraction.
Arrow A indicates an endothelial cell located in the intima of the arteriole.
Nitric oxide, also known as endothelial cell relaxing factor (EDRF),
is produced from arginine by endothelial cells. A muscarinic agonist
can lead to the evolution of NO, producing vasodilatation.
Arrow B indicates a polymorphonuclear leukocyte in the bloodstream.
Arrow C indicates the basal lamina underlying the endothelium.
Arrow D indicates the arteriolar adventitia.
7>The correct answer is B. Hyperlipidemia has been subclassified based on
the lipid and lipoprotein profiles. Type 2a, which this patient has, can
be seen in a hereditary form, known as familial hypercholesterolemia, and
also in secondary, acquired forms related to nephritic syndrome and
hyperthyroidism. The root problem appears to be a deficiency of LDL
receptors, which leads to a specific elevation of cholesterol in the
form of increased LDL. Heterozygotes for the hereditary form generally
develop cardiovascular disease from 30 to 50 years of age. Homozygotes
may have cardiovascular disease in childhood.
Type 1 (choice A) is characterized by isolated elevation of chylomicrons.
Type 2b (choice C) is characterized by elevations of both cholesterol and
triglycerides in the form of LDL and VLDL.
Type 3 (choice D) is characterized by elevations of triglycerides
and cholesterol in the form of chylomicron remnants and IDL.
Type 5 (choice E) is characterized by elevations of triglycerides
and cholesterol in the form of VLDL and chylomicrons.
8>The correct answer is D. Wernicke-Korsakoff syndrome refers to the
constellation of neurologic symptoms caused by thiamine deficiency.
Among these, a severe memory deficit, which the patient may attempt to cover by making up bizarre explanations (confabulation), is prominent. Anatomical damage to the mamillary bodies and periventricular structures has been postulated as the cause. In the U.S., severe thiamine deficiency is seen most commonly in chronic alcoholics. Thiamine deficiency can also damage peripheral nerves ("dry" beriberi) and the heart ("wet" beriberi).
Folic acid deficiency (choice A) produces megaloblastic anemia without
neurologic symptoms.
Niacin deficiency (choice B) produces pellagra, characterized by depigmenting dermatitis, chronic diarrhea, and anemia.
Riboflavin deficiency (choice C) produces ariboflavinosis, characterized
by glossitis, corneal opacities, dermatitis, and erythroid hyperplasia.
Vitamin B12 deficiency (choice E) produces megaloblastic anemia accompanied
by degeneration of the posterolateral spinal cord.
9>The correct answer is A. Fibrinogen is cleaved by thrombin twice as it is activated to form fibrin. The initial cleavage causes it to polymerize and the second causes it to branch. Thrombin also activates Factor XIII to XIIIa, which crosslinks the fibrin strands and strengthens the clot.
HMWK (choice B) is a cofactor in the intrinsic pathway that converts Factor XI to XIa.
Plasminogen (choice C) is a central proenzyme in clot lysis. When plasminogen is converted to plasmin, it digests fibrin threads, as well as a number of protein factors including Factors V, VIII, XII, and prothrombin.
Thrombin (choice D) is an enzyme derived from prothrombin. It converts fibrinogen to fibrin, and activates factor XIII.
vWF (choice E) is a tissue-bound protein which is exposed with vascular trauma and helps in the process of platelet adhesion.
10>The correct answer is B. One of the most common side effects of any antineoplastic therapy is weight loss secondary to decreased appetite and/or nausea and vomiting. Furthermore, weight loss due to decreased food intake tends to occur more frequently in elderly patients receiving antineoplastic therapy. One medication that has consistently helped to increase appetite in such patients is megestrol acetate. This agent is a progestational hormone with antineoplastic properties used in the treatment of advanced carcinoma of the breast and endometrium. Megestrol, when given in relatively high doses, can substantially increase the appetite in most individuals, even those with advanced cancer.
Amitriptyline (choice A) is a tricyclic antidepressant used in the treatment of depression. There is nothing mentioned in the case study to suggest that the patient is clinically depressed; hence, this agent would provide no benefit.
Methotrexate (choice C) is an antimetabolite and folic acid antagonist commonly used in various neoplastic disorders and in the treatment of rheumatoid arthritis. Since nausea, vomiting, and ulcerative stomatitis are common side effects of this medication, its usage in this patient would not be recommended.
Neostigmine (choice D) is a carbamylating acetylcholinesterase inhibitor that would not increase appetite.
Prochlorperazine (choice E) is a phenothiazine derivative used primarily to control severe nausea and vomiting. This patient is not experiencing nausea. Furthermore, this agent does not possess appetite-stimulating properties.
11>The correct answer is A. Anthrax forms extremely stable spores and has, in fact, been encountered in very old (i.e., deep) dirt in Israeli and Arabian excavation sites. The causative organism, Bacillus anthracis, is found in many animal species, and humans can acquire the organism either through contact with the animals or from locally contaminated soil. The pustule described in the question stem is called a "malignant pustule" and may be accompanied by lymphadenopathy. Most cases remain localized, but death can occur as the result of complications such as bacteremia, meningitis, and pneumonia.
Borrelia burgdorferi (choice B) causes Lyme disease. In the first stage of this disease, there is a localized expanding erythematous rash rather than an eschar. Furthermore, Lyme disease occurs in the U.S., Europe, and Asia, corresponding to the distribution of Ixodid ticks, which spread the infection.
Francisella tularensis (choice C) causes tularemia. The organism can persist for weeks to months but does not form spores that could survive for hundreds or thousands of years. Also, most human cases occur in the endemic areas of the U.S.
Spirillium minus (choice D) is one of the causes of rat-bite fever. There is no indication the man was bitten by a rat.
Yersinia pestis (choice E) causes bubonic plague. This organism does not form stable spores that could survive for extended periods of time.
12>The correct answer is C. This is a classic presentation of a patient with carpal tunnel syndrome, which typically affects females between the ages of 40 and 60 who chronically perform repetitive tasks that involve movement of the structures that pass through the carpal tunnel. One important structure that passes through the carpal tunnel is the median nerve. Patients often note a tingling, a loss of sensation, or diminished sensation in the digits. There is also often a loss of coordination and strength in the thumb, because the median nerve also sends fibers to the abductor pollicis brevis, flexor pollicis brevis, and the opponens pollicis. A final function of the median nerve distal to the carpal tunnel is control of the first and second lumbricals which function to flex digits two and three at the metacarpophalangeal joints and extend interphalangeal joints of the same digits.
Abduction of the fifth digit (choice A) is a function controlled by the ulnar nerve, which does not pass through the carpal tunnel.
Adduction of the thumb (choice B) is a function of the adductor pollicis, which is the only short thumb muscle that is not innervated by the median nerve, but rather by the deep branch of the ulnar nerve.
Sensation of the lateral half of the dorsum of the hand (choice D) is mediated by the radial nerve, which also does not pass through the carpal tunnel.
Sensation over the lateral aspect of the palm (choice E) is mediated by the median nerve, however the branch innervating the palm (palmar cutaneous branch of the median nerve) passes superficial to the carpal tunnel.
Sensation over the medial aspect of the dorsum of the hand (choice F) is mediated by the ulnar nerve.
Sensation over the medial aspect of the palm (choice G) is mediated by the ulnar nerve.
13>The correct answer is D. Duchenne muscular dystrophy (DMD) is a lethal, X-linked recessive disease affecting approximately 1 in 3300 live male births. The disease becomes symptomatic in early childhood. Inability to walk occurs by the end of the first decade, and death usually occurs by the second decade. Nearly all patients show the complete absence of the protein dystrophin, which is abundant in skeletal and cardiac muscle. The dystrophin gene (or DMD gene), located at Xp21, is approximately 2300 Kb in size, making it one of the largest known genes of any species. It contains 24 regions of 109 amino acids that are similar but not identical repeats of each other. In women, the similarity of these sequences can lead to the misalignment of homologous material at meiotic synapsis. In association with a recombination event, this misalignment gives rise to frameshift mutations, leading to an untranslatable mRNA. This series of events occurs at an extremely high rate of about 1 in 10,000. In fact, one third of DMD cases in each generation arise from this mechanism.
Diseases such as fragile X syndrome and Huntington disease are caused by the expansion of a trinucleotide repeat (choice A).
Infidelity (choice B) is not a plausible explanation for the child because the trait is an X-linked recessive condition. A male child must receive the DMD trait on the maternal X chromosome. The father of the child contributes only a Y chromosome, and the history stated that the mother had no family history of the disorder.
DMD in a patient with no family history is not generally due to a point mutation in the dystrophin gene (choice C).
Rare cases of DMD in females have been caused by an X chromosome-autosome translocation (choice E) with the breakpoint on the X chromosome within the DMD gene. Because of the translocation, only the cells in which the normal X chromosome is inactivated survive in the female zygote. This gives rise to a female who is heterozygous for the DMD gene but phenotypically expresses the disease.
14>The correct answer is B. The great saphenous vein is one of the two major superficial veins of the lower limb. It is found in the superficial fascia, where it is accessible for procedures such as saphenous cutdown and saphenous venous graft. As the vein ascends along the lower limb, it passes anterior to the medial malleolus at the ankle and posterior to the medial side of the knee. The vein then passes through the saphenous hiatus of the fascia lata to empty into the femoral vein slightly below the inguinal ligament.
No major vein is found anterior to the lateral malleolus (choice A).
Veins on the dorsum of the foot (choice C) are small tributaries of the great and small saphenous veins.
The small saphenous vein passes posterior to the lateral malleolus (choice D).
There are no major superficial veins that pass posterior to the medial malleolus (choice E). In this region, under the deep fascia, will be found the posterior tibial artery and vein, along with the tibial nerve.
15>The correct answer is D. The child is suffering from minimal change or nil disease (lipoid nephrosis), which has a peak incidence at 2-3 years of age. Minimal change disease can be associated with food allergies, medications, or hematologic malignancies, or it can occur idiopathically. The pathology does not appear to involve complement, immunoglobulins, or immune complex deposition. Rather, an altered cell-mediated immunologic response with abnormal secretion of lymphokines by T cells is thought to reduce the production of anions in the glomerular basement membrane, thereby increasing the glomerular permeability to plasma albumin through a reduction of electrostatic repulsion. The loss of anionic charges is also thought to favor foot process fusion. Some authors have noted that other conditions associated with T-cell abnormalities, such as Hodgkin's disease and T-cell lymphoma, are sometimes associated with minimal change disease.
Consumption of complement factors (choice A) is observed in many conditions in which complement activation occurs, for example, membranoproliferative glomerulonephritis.
IgG directed against renal and pulmonary basement membranes (choice B) is found in Goodpasture's syndrome, a cause of rapidly progressive glomerulonephritis and hemoptysis.
Immune complex deposition (choice C) is associated with type III hypersensitivity reactions, including postinfectious glomerulonephritis, lupus nephritis, Henoch-Schönlein purpura, cryoglobulinemia, and bacterial endocarditis.
Mesangial IgA deposition (choice E) is associated with Berger's disease, or IgA nephropathy, a cause of glomerulonephritis.
16>The correct answer is E. Wiskott-Aldrich syndrome is an X-linked condition characterized by eczema, thrombocytopenia, and repeated infections. Affected children may present with bleeding and often succumb to complications of bleeding, infection, or lymphoreticular malignancy. The platelets are small, have a shortened half-life, and appear to be deficient in surface sialophorin (CD43). Splenectomy can correct the thrombocytopenia, but not the immune defect. Serum IgM is usually decreased, while IgE is frequently increased. Mutations in the Wiskott-Aldrich serum protein (WASP) gene on the short arm of the X chromosome are responsible for this disease.
Acquired hypogammaglobulinemia (choice A) is a disease of adults characterized by normal numbers of B cells but low immunoglobulin production.
Ataxia telangiectasia (choice B) is an autosomal recessive disease characterized by progressive cerebellar dysfunction, telangiectasias, and a variable immunodeficiency.
DiGeorge syndrome (choice C) is a developmental malformation leading to thymic aplasia and, sometimes, hypoparathyroidism.
Selective IgA deficiency (choice D) is a relatively common condition characterized by low levels of IgA.
17>The correct answer is D. The key symptom is hyperventilation. Hyperventilation results in hypocapnia, alkalosis, increased cerebrovascular resistance, and decreased cerebral blood flow. Carbon dioxide plays an important role in the control of cerebral blood flow. An increase in arterial PCO2 dilates blood vessels in the brain and a decrease in PCO2 causes vasoconstriction. The anxious, hyperventilating woman is "blowing off" carbon dioxide, which lowers her arterial PCO2. This decrease in PCO2 has caused the cerebrovascular resistance (choice E) to increase, thereby decreasing cerebral blood flow. The decrease in cerebral blood flow has caused the woman to feel faint and to have blurred vision. Other symptoms commonly associated with the hyperventilation of anxiety states are feelings of tightness in the chest and a sense of suffocation.
Hyperventilation increases the arterial oxygen content (choice A) and PO2 (choice B) in a normal person.
A decrease in arterial PCO2 causes the arterial pH (choice C) to increase, i.e., the patient becomes alkalotic.
18>The correct answer is E. Sheehan's syndrome is hypopituitarism due to ischemic damage to the pituitary resulting from excessive hemorrhage during parturition. The pituitary is enlarged during pregnancy; it is more metabolically active, and more susceptible to hypoxemia. Furthermore, the blood vessels in the pituitary may be more susceptible to vasospasm because of the high estrogen. In about 30% of women who hemorrhage excessively during parturition, some degree of hypopituitarism eventually becomes manifest. The symptoms depend on how much of the pituitary is damaged and what cell types are destroyed. The patient described above exhibited persistent amenorrhea after delivery of her infant. This is due to destruction of pituitary gonadotrophs and diminished secretion of gonadotropins (LH). There also appears to have been significant destruction of lactotrophs since TRH injection failed to induce an increase in prolactin. Had the women attempted to breast-feed her infant, a failure to lactate mostly likely would have occurred. This case is also characterized by secondary hypothyroidism. The low TSH and failure to respond to TRH injection is confirmatory. Corticotrophs appear to have been spared since plasma ACTH is normal. It is not clear whether somatotrophs were damaged. Further testing would be needed to see if GH reserve is diminished.
Hashimoto's thyroiditis (choice A) is an autoimmune disorder that produces primary hypothyroidism. Because of diminished negative feedback effects of T4, serum TSH is usually increased (not decreased).
Isolated gonadotropin deficiency (choice B) produces amenorrhea and is associated with low serum LH and estradiol. Hypogonadotropic hypogonadism can occur in female athletes that over-train, in anorexia nervosa, in obesity, or with other emotional or physical stresses. However, other pituitary hormones are unaffected (by definition isolated gonadotropin deficiency only involves a decrease in gonadotropins).
Primary amenorrhea (choice C), by definition, means failure of menstrual cycles to ever begin. Since this woman has delivered a baby, primary amenorrhea is highly unlikely.
A prolactinoma (choice D) is a functional pituitary tumor that secretes excessive prolactin. This can cause amenorrhea by suppressing the GnRH-pituitary-gonad axis. The patient described above has decreased prolactin secretion.
19>The correct answer is C. The child has subacute sclerosing panencephalitis (SSPE), which is fortunately a very rare, late complication of measles infection at an early age. The existence of this complication is part of the rationale to immunize children to measles at an early age. It is thought that very young children's immune and neurologic systems may permit the virus to become established in the brain. The exact mechanism of injury is poorly understood, but the brain shows encephalitis involving both gray and white matter. 40% of cases die within 1 year, and it is thought that the disease is probably always eventually fatal.
None of the other diseases progresses to SSPE.
20>The correct answer is B. The diagnosis of chronic bronchitis requires the presence of chronic productive cough over at least 3 months of the year for 2 successive years. The symptoms in this patient (green productive sputum, fever) suggest that he has an acute infection superimposed on chronic bronchitis (history of cigarette smoking, history of excessive mucus production over many years). Histologically, the mucus-producing glands in the bronchi would show hyperplasia and hypertrophy and extend to a greater depth in the bronchial wall, resulting in a higher Reid index (ratio of thickness of mucus gland to thickness of bronchial wall).
Although the patient is a smoker and is at increased risk for bronchogenic carcinoma (choice A), this is unlikely to be the cause of his symptoms. Hemoptysis and weight loss might also be present if he had cancer.
Cystic fibrosis (choice C) presents earlier in life and may be associated with severe production of mucus, especially if bronchiectasis supervenes. The age of the patient and the relative late onset of disease preclude this diagnosis.
This patient may also have emphysema (choice D), as chronic bronchitis and emphysema are often coexistent. However, although pure emphysema might cause dyspnea, it would not be associated with a fever or a productive cough.
Pulmonary tuberculosis (choice E) would typically present with a history of hemoptysis rather than abundant green sputum. Weight loss, night anorexia, malaise, and weakness may also be present.
21>The correct answer is E. The thyroglossal duct develops as an evagination of the floor of the pharynx in the region where the tongue develops. The adult foramen cecum of the tongue marks the site of this evagination. The distal end of this duct normally forms the thyroid gland; the proximal part of the duct normally degenerates. Failure of a part of the duct to degenerate may lead to a thyroglossal duct cyst or median cervical cyst, as seen in this patient.
The first pharyngeal cleft (choice A) forms the external ear canal. This cleft normally remains patent.
The first pharyngeal pouch (choice B) forms the middle ear cavity and the auditory tube. This pouch normally remains patent.
The second pharyngeal cleft (choice C) normally does not remain patent. It is typically covered over by the overgrowth of the second pharyngeal arch. If part of this pouch does remain patent, it may form a lateral cervical cyst, which is seen on the lateral side of the neck along the posterior border of the sternocleidomastoid muscle.
The second pharyngeal pouch (choice D) forms the tonsillar fossa of the pharynx. The pharyngeal mucosa in this area arises from the endoderm of the pouch. Ingrowth of mesoderm cells results in the formation of the palatine tonsil.
22>The correct answer is D. The disease is hairy cell leukemia, which, unlike most forms of leukemia, is characterized by pancytopenia rather than increased numbers of circulating cells. This disease tends to affect older men and the characteristic cells (which are not always obviously "hairy") are positive for tartrate-resistant acid phosphatase (TRAP).
Associate Birbeck granules (choice A) with Langerhans cell histiocytosis (histiocytosis X).
Associate elevated leukocyte alkaline phosphatase (choice B) with myeloid metaplasia.
Associate Philadelphia chromosome (choice C) with chronic myeloid leukemia (and occasionally with acute lymphocytic leukemia).
Associate production of Bence-Jones proteins (choice E) with multiple myeloma.
23>The correct answer is A. Most of the venous drainage of the skin of the lower extremity is to the long saphenous vein, the accompanying lymphatics of which drain into the superficial group of the inguinal lymph nodes. However, the skin drained by the short saphenous vein, including that of the lateral aspect of the dorsum of the foot, is an exception to this rule. Lymphatic fluid from this area drains into lymphatics accompanying the short saphenous vein, then drains into lymph nodes behind the knee in the popliteal fossa.
The lateral side of the thigh (choice B), the medial side of the leg below the knee (choice C), the medial side of the sole of the foot (choice D), and the medial side of the thigh (choice E) all drain to the superficial inguinal nodes.
24>The correct answer is C. Questions like these are particularly amenable to the use of test-taking strategies because even if you don't know 100% of the answer, you will be able to eliminate some answer choices based on the knowledge you do have. For example, you probably were aware that the peritoneum does not lie above the transversus abdominis muscle, enabling you to eliminate choice A and to increase your chances of answering correctly by 20%. Note that this is a question surgeons love to ask students, so keep this information in mind in the OR!
25>The correct answer is A. The Halstead-Reitan Battery is a group of tests that reflects the basic and higher level cognitive and neuro-sensory functioning of the entire brain, and can be used in a serial fashion with little learning effect being present. Since there is recovery of function for up to 2 years post CNS-trauma, test results can demonstrate that the present loss the patient is experiencing is not permanent.
The Stanford Binet Intelligence Test (choice B), used in the adult, mainly reflects verbal skills and consequently would miss large portions of this man's situation.
The Vineland Adaptive Behavior Scale (choice C) assesses developmental and social functioning, not cognitive and neuro-sensory abilities.
The Wechsler Adult Intelligence Scale (choice D) confines its results to intelligence assessment and does not assess more basic issues like aphasia and neuro-sensory skills.
The Wide Range Achievement Test (choice E) assesses academic achievement only.
26>The correct answer is B. The reaction was precipitated by a stressful event that would cause anyone to experience a severe and intense emotional response. The symptoms occurred within 3 months of the event and lasted for less than 6 months after the trauma, all corresponding to the diagnosis of adjustment disorder with mixed anxiety and depressed mood.
Acute stress disorder (choice A) and post-traumatic stress disorder (choice E) both require that the person reexperience the traumatic event in wakeful or dream states and the presence of dissociative symptoms.
This is not a major depressive disorder (choice C) because her symptoms are not of psychotic proportion and there is a clear precipitating stimulus.
Panic disorder without agoraphobia (choice D) is incorrect because the panic episodes are uncued and not the response to an environmental stressor.
27>The correct answer is D. The patient has acute prostatitis, which is characterized by fever, chills, and dysuria, with a swollen, extremely tender prostate on rectal exam. The urine Gram's stain and culture will generally be positive. The treatment regimen for this bacterial infection is typically a 21-day course of ampicillin, a fluoroquinolone, or sulfamethoxazole/trimethoprim (SMX-TMP). G-6-PD deficiency is an X-linked recessive disorder affecting 10% to 15% of American black males. The medications most commonly associated with the induction of hemolytic anemia in deficient patients are sulfonamides, nitrofurantoin, dapsone, primaquine, and quinine. The sulfamethoxazole in the SMX-TMP combination is a sulfonamide, and can produce hemolytic anemia in patients with G-6-PD deficiency.
Ampicillin (choice A) is a broad-spectrum penicillin antibiotic commonly used in the treatment of infections in the genitourinary, respiratory, or GI tracts, as well as in the skin and soft tissues.
Cefaclor (choice B) is a second-generation cephalosporin indicated for a variety of bacterial infections, including those of the respiratory and GI tracts.
Ciprofloxacin (choice C) is a fluoroquinolone commonly used in the treatment of serious infections caused by gram-negative organisms.
Tetracycline (choice E) is most commonly used in the treatment of acne vulgaris and gonococcal infections.
28>The correct answer is E. Testicular feminization is a disorder of the androgen receptor. Phenotypically, the patient appears female, but has a blindly ending vagina and lacks a uterus or other female internal reproductive organs. The patient has an XY genotype. Since the gene for testes determining factor (TDF) is on the Y chromosome, TDF will cause the indifferent gonad to develop into a testis containing Sertoli cells. Sertoli cells at this stage will secrete MIF, a substance that suppresses the paramesonephric ducts, preventing the formation of female internal reproductive organs.
This patient would not have a streak ovary (choice A), a finding in Turner's syndrome that is associated with a 45,XO genotype. In fact, the patient would have testes, since the genetic complement contained a Y chromosome. The testes in individuals with testicular feminization syndrome are often undescended and are usually removed surgically.
This patient would not possess a uterus (choice B) or an oviduct (choice C). Both of these structures are derived from the paramesonephric duct, which is suppressed by MIF.
Depressed levels of testosterone (choice D) would not occur in this patient. In fact, individuals with testicular feminization syndrome have normal or even slightly elevated levels of testosterone. The development of female external genitalia is the result of defective androgen receptors, not depressed levels of testosterone.
29>The correct answer is A. The right lymphatic duct drains the right arm, the right side of the chest, and the right side of the head. The thoracic duct drains the rest of the body. Both the right lymphatic duct and the thoracic duct dump into the large venous channels at the base of the neck. Occlusion of this drainage can produce intractable edema in sites feeding these ducts.
The left side and right leg would be affected, rather than the right side and left leg (choice B).
The entire left side (rather than just the left arm, choice C) and right leg drain into the thoracic duct.
The right arm and the right half of the head (choices D and E) drain to the right lymphatic duct.
30>The correct answer is A. This is a classic presentation of a pulmonary abscess. Chronic courses with less severe symptoms (with intermittent improvement following short courses of antibiotics) are also sometimes seen, particularly if the diagnosis was not suspected. Chest x-ray typically shows pneumonic opacification in which a cavity, often with a fluid level, is visible. Pulmonic abscesses can be caused by anaerobes (most common, particularly if aspiration initiated the abscess), gram-negative aerobic bacilli, and Staphylococci. Therapy is based on the organisms isolated, and should be continued for at least 4 to 6 weeks. In cases that fail to resolve, the possibility of coexisting carcinoma should be considered.
Choice B is the x-ray appearance of pleural effusion.
Choice C is the x-ray appearance of lobar pneumonia.
Choice D is the x-ray appearance of bronchopneumonia.
Choice E is the x-ray appearance of bronchiectasis.
31>The correct answer is C. The corpus luteum secretes estrogens, progesterone, and relaxin. hCG, secreted by the syncytiotrophoblast lining the placental villi, maintains the corpus luteum during the first trimester of pregnancy.
Antidiuretic hormone (vasopressin; choice A) does not play a significant role during pregnancy.
FSH (choice B) acts on granulosa cells to promote the conversion of androstenedione to estradiol.
LH (choice D) acts on theca cells to promote androstenedione secretion.
Progesterone (choice E) is important for maintaining the pregnancy, however, it does not act to maintain the corpus luteum.
32>The correct answer is C. The boy probably has Klinefelter's syndrome (47, XXY), which has the typical presentation described in the question. The condition arises as a result of failure of separation (nondisjunction) of the sex chromosomes, and can be related to either paternal nondisjunction (slightly more common) or maternal nondisjunction.
Deletions (choice A) are a common form of genetic disease and contribute to many genetic recessive diseases.
Examples of nondisjunction of autosomes (choice B) include trisomies such as most cases of Down's syndrome (trisomy 21), Edwards' syndrome (trisomy 18), and Patau syndrome (trisomy 13).
There are two types of translocations: non-Robertsonian (choice D) and Robertsonian (choice E). Non-Robertsonian (reciprocal) translocations result when two non-homologous chromosomes exchange genetic material. Robertsonian translocations are a special type of translocation that involve exchange of genetic material from the long arms of one acrocentric chromosome to the long arms of another acrocentric chromosome, with fusion of the centromeres. Four percent of cases of Down's syndrome are caused by this mechanism.
33>The correct answer is E. A femoral hernia exits the abdominal cavity through the femoral ring to enter the femoral canal. The femoral ring is bounded medially by the lacunar ligament. Compression of the herniated intestine against the sharp edge of the lacunar ligament may cause strangulation of the intestine. The other borders of the inguinal ring are the inguinal ligament anteriorly, the pubis posteriorly, and the femoral vein laterally.
The femoral artery (choice A) is within the femoral sheath along with the femoral hernia, but is lateral to the femoral vein, which separates the artery from the hernia.
The femoral nerve (choice B) is not inside of the femoral sheath, but is lateral to the sheath.
The femoral vein (choice C) is lateral to the femoral canal within the femoral sheath.
The inferior epigastric artery (choice D) is not related to a femoral hernia. This artery is on the anterior abdominal wall and passes immediately medial to the deep inguinal ring. Indirect inguinal hernias pass lateral to this artery and direct inguinal hernias pass medial to this artery.
34>The correct answer is B. The border modification consists of cilia on the surface of pseudostratified columnar epithelium. Cilia are shorter than stereocilia and usually appear bent or wavy in sections. Kartagener's syndrome is one type of immotile cilia syndrome in which the dynein arms of microtubules are missing or defective. Thus, cilia cannot move properly and all functions associated with them are affected (mucous sweeping or ciliary elevator functioning, sperm motility, embryonic cell movement, etc.). The result is infertility, situs inversus, bronchiectasis and/or sinusitis.
Implantation (choice A) is not affected in patients with Kartagener's syndrome. The fertilized ovum can still reach the endometrium and implantation can occur. Also, this is not a section of the uterine tube; the uterine tube has a simple columnar epithelium with peg cells (secretory) and ciliated cells.
The border modification consists of cilia, not microvilli and the specimen is not a section of the intestine, therefore malabsorption (choice C) is incorrect. Both the small and large intestine have a simple columnar epithelium with microvilli. Microvilli are upright and irregular and resemble a "flat top" haircut across the top of cells.
Disaccharidases (choice D) are present in the cell membrane of microvilli. Deficiencies in digestion occur with the loss of microvilli.
35>The correct answer is D. While not of major medical concern, urine color changes as a result of medications can be very distressing to patients. These changes are consequently worth learning so that you can warn patients when you prescribe the medicine. Rifampin is a safe drug that is used both for prophylaxis and for active tuberculosis therapy. In addition to discoloring urine, rifampin and its metabolites can discolor feces, saliva, sweat, and tears (and apparently can stain soft contact lenses).
Ethambutol (choice A) is an antituberculosis agent that is added if isoniazid-resistance is suspected and does not alter urine color.
Isoniazid (choice B) remains the principle antituberculosis agent and does not alter urine color.
Pyridoxine (choice C) is used principally in prophylaxis against tuberculosis and does not alter urine color.
Streptomycin (choice E), which must be given intramuscularly, is sometimes used as an adjunctive agent very early in antituberculosis therapy and has sometimes been lifesaving in critically ill patients. It does not cause a urine color change.
36>The correct answer is B. This question illustrates an important strategy: knowing what you're looking for before you consider the answer choices. If you thought about the answer before considering the choices, this question was very straightforward and simple. If, on the other hand, you considered each answer choice in turn, you no doubt got pretty confused and wasted a lot of precious test time.
The first thing to remember is that nephrotic syndrome is defined as proteinuria (over 3.5 gm/day) with concurrent hypoalbuminemia and hyperlipidemia. The loss of protein in the urine results in a decreased oncotic pressure in the vascular space (decreased pc). This decrease in capillary oncotic pressure promotes movement of fluid into the interstitium and the development of edema. This is also the cause of edema in patients with liver disease.
Decreased interstitial oncotic pressure (pi; choice D) would actually promote the movement of fluid into the vasculature; it would not lead to edema. The same thing would occur with decreased capillary hydrostatic forces (Pc; choice A).
While decreased interstitial hydrostatic pressure (Pi; choice C) would lead to edema, it is not the mechanism of action in nephrotic syndrome.
While increased capillary hydrostatic pressure (choice E) does lead to edema, it is not the mechanism at work in nephrotic syndrome. It is, however, the mechanism of edema in the setting of congestive heart failure (increased capillary hydrostatic pressure due to inefficient pumping of the heart, leading to pooling) and in glomerulonephritis (increased intravascular volume due to inefficient excretion by the kidney).
Increased capillary oncotic pressure (choice F) would not lead to edema.
Increased interstitial hydrostatic pressure (choice G) would not lead to edema.
Increased interstitial oncotic pressure (choice H) would cause edema, but not in the setting of nephrotic syndrome. Instead, this is the mechanism of edema (typically localized) in the setting of burns and inflammation (increased capillary permeability allows protein to leak into interstitium and increase oncotic pressure).
37>The correct answer is D. Looking at the coding segment of the normal b-gene of hemoglobin, one should read the information codon by codon, as follows:
AAG UAU CAC UAA GCU CGC
1 2 3 4 5 6
The normal b-globin gene has a stop codon (UAA) at the 4th position, therefore the last 2 codons (GCU and CGC) are not translated and do not code for amino acid residues found in the protein. Comparing this information to the coding segment of the mutated b-gene of hemoglobin Cranston, one would notice the following:
AAG AGU AUC ACU AAG CUC GCU UUC ...UAU UAA
1 2 3 4 5 6 7 8 ...etc
The insertion of two base pairs (AG) results in a frameshift mutation that eliminates the stop codon at position 4, thereby causing the addition of amino acids normally not translated in the hemoglobin b-chain of the child. Since the chain is now too long, this destabilizes the tetrameric conformation of hemoglobin.
A frameshift mutation resulting in deletion of several amino acids (choice A) is wrong, since such a mutation would have inserted a stop codon (UAA, UGA or UAG) before position 4.
A mutation in the stop codon (choice B) would have resulted in a longer-than-normal b-globin gene, but the information given does not indicate any changes in the stop codon at position 4. Interestingly, a chain elongation by mutation in the stop codon exists and is known as hemoglobin Constant Spring, affecting the a-chain of hemoglobin.
A point mutation (choice C) is the result of a single base pair change, which is not the case here. A point mutation resulting in the insertion of a new stop codon is called a nonsense mutation, and it would result in a shorter-than-normal protein.
A two base pair deletion (choice E) is not evidenced by the coding sequence given in the stem. It would also cause a frameshift in the reading frame with the possible result of a longer or shorter protein, most likely with abnormal function due to the change in primary structure (amino acid sequence).
Strategy note: Since the hemoglobin Cranston b-chain is clearly longer than the normal b-chain, choices A, C, and E, which would produce a shorter chain, can be eliminated immediately.
38>The correct answer is B. The drawing depicts the histology of the small intestinal villus and crypts. The arrow points to a Paneth cell. Paneth cells are unique to the small intestine. They are found at the base of the crypts of Lieberkühn in the small intestinal villi, and have many secretory granules that contain enzymes with bactericidal activity.
The enteroendocrine cells of the stomach produce low-molecular weight polypeptides (choice A).
There are no lipase-secreting cells in the small intestine (choice C). Lipases are secreted by cells in the salivary glands, stomach, and exocrine pancreas. So, even if you did not know that the arrow pointed to Paneth cells, you should have eliminated this choice based on the fact that the small intestine does not secrete lipase.
The goblet cells of the small intestinal villi are responsible for producing protective glycoproteins called mucins (choice D). After secretion, they are hydrated and become a mucous layer that protects the intestinal epithelium. There are many goblet cells depicted in this figure, but they are not located at the bases of the crypts.
Pepsinogen (choice E) is secreted by the chief cells of the stomach.
39>The correct answer is D. Many people who request physician-assisted suicide have one of two conditions present: either a poorly controlled painful condition or severe depression. If the painful condition is adequately treated or the depression is brought under good medical control, the request for physician assistance in terminating the situation is typically withdrawn. It is important to note that bringing these conditions under control requires the intervention of caregivers who are specifically trained in the management of these two conditions; primary care physicians usually are not adequately trained to address these difficult presentations.
While patients who are diagnosed as bipolar disorder (choice A), borderline personality disorder (choice B), and schizophrenic disorder (choice E) often make suicide attempts (and frequently complete those attempts), they do not generally ask their physician for assistance in the suicide.
Persons with factitious disorder (choice C) are seeking primary gain, often for dependency needs, and are seeking to enter the "sick role" not the "dead role.
40>The correct answer is B. First, eliminate all answers in which Drug X does not produce an increase in blood pressure (BP). Choice A should be eliminated because acetylcholine stimulates the noninnervated muscarinic (M3) receptors that are located on endothelial cells of the vasculature. Stimulation of these receptors releases endothelial-derived relaxing factor (EDRF; nitric oxide), which produces a relaxation of the neighboring smooth muscle cells, leading to a decrease in BP. Choice C should be eliminated because isoproterenol (a nonspecific beta agonist) decreases BP by stimulating beta-2 receptors in the vasculature.
Epinephrine, norepinephrine, and phenylephrine all increase BP, so the remaining answers must be eliminated by examining the effects of Drug Y on Drug X. Start with choice B: Epinephrine is an agonist at alpha-1, alpha-2, beta-1, and beta-2 receptors; phentolamine is an antagonist at alpha-1 and alpha-2 receptors. Therefore, after the administration of phentolamine, epinephrine can stimulate only beta receptors, which would produce a decrease in BP. Epinephrine is now acting like isoproterenol. This is called epinephrine reversal (the name stems from the fact that epinephrine originally increases BP and then produces the opposite effect after phentolamine administration). Therefore, choice B is correct.
Choice D: Norepinephrine is an agonist at alpha-1, alpha-2, and beta-1 receptors; propranolol is a nonselective beta antagonist. After administration of propranolol, norepinephrine can stimulate only alpha receptors, which will still cause vasoconstriction (primarily via alpha-1 stimulation in the vasculature) and therefore increase BP.
Choice E: Phenylephrine is an alpha-1 agonist; hexamethonium is a nicotinic ganglionic blocker. Hexamethonium administration would be predicted to eliminate the baroreceptor response after the second phenylephrine administration by blocking the peripheral ganglia. However, phenylephrine will still reach the alpha-1 receptors on the vasculature to produce an increase in blood pressure.
41>The correct answer is A. Bilirubin is a degradative product of hemoglobin metabolism. Bilirubin (pigment) stones are specifically associated with excessive bilirubin production in hemolytic anemias, including sickle cell anemia. Bilirubin stones can also be seen in hepatic cirrhosis and liver fluke infestation.
Calcium oxalate stones (choice B) and cystine stones (choice E) are found in the kidney, rather than the gallbladder.
Pure cholesterol stones (choice C) are less common than mixed gallstones, but have the same risk factors, including obesity and multiple pregnancies.
Mixed stones (choice D) are the common "garden variety" gallstones, found especially in obese, middle aged patients, with a female predominance.
42The correct answer is C. The probable organism is Giardia lamblia, which characteristically infects the small intestine. When seen in smears from duodenal aspirates, this flagellated organism has a characteristic "face-like" appearance. However, in biopsy specimens, the organism is often caught at an angle, and the characteristic appearance and location is as described in the question stem. Giardia is a common contaminant of water supplies (even in the United States), and patients who ingest the cysts may be asymptomatic or may occasionally develop prolonged diarrhea or intestinal malabsorption. Some patients with severe disease have low serum IgA or low overall immunoglobulin levels.
Entamoeba histolytica (choice A) usually infects the large intestine and/or liver.
Escherichia coli (choice B) is a bacterial cause of diarrhea.
Naegleria fowleri (choice D) causes meningoencephalitis.
Trichomonas vaginalis (choice E) causes vaginitis.
43The correct answer is A. The spinal cord arises from the caudal end of the neural tube. During development, an alar and a basal plate is formed, separated by a longitudinal groove called the sulcus limitans (choice E). The alar plate forms the dorsal (posterior) part of the spinal cord and becomes the sensory or afferent portion of the cord. The basal plate (choice B) is the ventral (anterior) part of the cord, and becomes the motor, or efferent, portion of the spinal cord, and therefore would contain anterior horn cells.
The neural crest (choice C) develops into multipolar ganglion cells of autonomic ganglia, pseudounipolar cells of spinal and cranial nerve ganglia, leptomeningeal cells, Schwann cells, melanocytes, chromaffin cells of the adrenal medulla, and odontoblasts.
The brain forms from the rostral end of the neural tube (choice D).
44>The correct answer is C. While the third-week embryo is a primitive trilaminar plate, in the fourth week, the heart begins to form and begins beating almost immediately. Hematopoiesis occurs in the yolk sac, and a primitive circulatory system connects the capillary plexuses of the yolk sac and chorion to the embryo. Partitioning of the atrium also begins in the fourth week. During the fifth week, cardiac septa form and the atrioventricular (AV) cushions fuse. By the sixth week, the heart is close to fully formed. This early sequence for the heart explains why it is so difficult to try to prevent congenital malformations of the cardiovascular system from occurring, since the mother of a 6-week-old fetus is only about 8 weeks from her last menstrual period, and may have assumed that she just "missed a period" (a very common phenomenon) for reasons other than pregnancy.
45>The correct answer is C. Laryngeal cartilages (e.g., the thyroid, cricoid, arytenoid cartilages) are derived from neural crest.
The endothelial cells (choice A) in the simple squamous epithelium that lines the pulmonary capillaries are derived from visceral mesoderm.
The epithelial lining of primary bronchi (choice B) is derived from endoderm.
Tracheal glands (choice D) and epithelium both derive from endoderm.
Type I pneumocytes (choice E) are derived from endoderm.
46The correct answer is C. The muscularis of the upper third of the esophagus (choice E) is composed entirely of striated muscle. The middle third (choice C) contains both striated and smooth muscle. The lower third (choice B) and lower esophageal sphincter (choice A) contain only smooth muscle. There is no such thing as the upper esophageal sphincter (choice D).
47>The correct answer is D. The cells of the anterior pituitary can be classified as chromophils (love dyes) or chromophobes (do not stain with dyes). The chromophils can be further divided into acidophils (stain with acidic dyes) and basophils (stain with basic dyes). The acidophils include the somatotropes, which secrete growth hormone, and the mammotropes, which secrete prolactin. The basophils include the corticotropes, which secrete ACTH (choice A), the gonadotropes, which secrete FSH and LH (choices B and C), and the thyrotropes, which secrete TSH (choice E).
48>The correct answer is E. The disease is myotonic dystrophy, which is an autosomal dominant disease; the affected gene has been localized to chromosome 19. Myotonic dystrophy is relatively common and is best thought of as a systemic disease, since it causes cataracts, testicular atrophy, heart disease, dementia, and baldness in addition to muscular weakness.
A mutation on the X chromosome (choice A) causes Duchenne muscular dystrophy.
None of the muscle diseases are known to be related to defects on the Y chromosome (choice B).
Facioscapulohumeral dystrophy is associated with a defective gene on chromosome 4 (choice C).
Infantile hypotonia has been related to defective genes on chromosome 5 (choice D).
49>The correct answer is E. Urinary tract infections are the most common bacterial infections encountered during pregnancy, and Escherichia coli is the most commonly isolated organism. 70% of cases in the U.S. are caused by P pili-positive strains.
Bundle-forming pili (choice A) are found in enteroaggregative E. coli (EAEC).
GVVPQ fimbriae (choice B) are fou |